Mutational screening in tyrosine-kinase domain of erbb1 and erbb2 genes

   MUTATIONAL SCREENING IN TYROSINE-KINASE DOMAIN OF erbB1
    AND erbB2 GENES

MUTATIONAL SCREENING IN TYROSINE-KINASE DOMAIN OF erbB1 AND erbB2 GENES

Juan Manuel Fern�ndez ALONSO, MS
Dept. of Biochemistry and Molecular Biology, Computence University, Madrid, Spain Madrid, Spain

Download as a PDF here

Professional Scientific Exchange Programme 13.5.43.
Short term visit, 3 months to Columbus, Ohio USA
The Ohio State University, James Cancer Hospital, Human Cancer Genetics Program, , Supervisor: Dr. Charis Eng

Juan Manuel Fern�ndez ALONSO, MS
Dept. of Biochemistry and Molecular Biology, Computence University, Madrid, Spain Madrid, Spain


INTRODUCTION

The protein-kinase family is the most frequently mutated gene family found in human cancer. The Epidermal Growth Factor Receptor (EGFR or erbB1) and the Receptor Protein-tyrosine Kinase erbB2 (HER2, Neu, erbB2) are transmembrane glycoproteins with intrinsic tyrosine kinase (TK) activity. Upon ligand binding, those TK-receptors are autophosphorylated, serving as a high affinity-binding site for citosolic substrates, thus transducing downstream signals required for cellular responses. In this way, the TK-protein family has been suggested to have a role in cancer development and progression. Thus, aberrant expression and activation of EGFR/erbB2 tyrosine kinase domains has been implicated in several key aspects of human neoplasia such as increased proliferation, survival, and invasiveness of cancer cells (Nicholson et al.2001). For example, abundant expression of EGFR has been detected in Non Small Cell Lung Cancer (NSCLC) human tumor specimens (Nguyen et al.2004) and abundant expression of erbB2 has been detected in Breast Cancer (BC).

Based on these multiple impacts on cancer cell physiology, the EGFR and erbB2 tyrosine kinases domains have been recognized as an attractive molecular target for selective treatment of solid tumors with increased TK activity levels. Thus, oral small molecule inhibitors of EGFR-TK domain, gefitinib and erlotinib, were approved for the treatment of patients with NSCLC (Lynch et al.2004) (Tracy et al.2004). Those works have idicated that the presence of somatic mutations in the tyrosine kinase domain of the EGFR is a major determinant of the response to the tyrosine kinase inhibitors genitinib and erlotinib. Lynch et al. proposed that a subgroup of patients with NSCLC have specific mutations in the EGFR gene, wich correlate with clinical responsiveness to the TK-Inhibitor gefitinib; these mutations lead to increased growth factor signaling and confer susceptibility to the inhibitor.

However this is still unclear and further work is needed to identify the factors underlying the response in those who do not carry mutations (Speake et al.2005).

MATERIALS AND METHODS

In my stage at the Human Cancer Genetics Program, Comprehensive Cancer Center (Ohio State University), I participated in the EGFR and erbB2 tyrosine kinase mutational analysis study whose aim was to determine the biological basis for differential responses to tyrosine kinase inhibitors (Weber et al. 2005).

The TK domain of EGFR, encoded by exons 18-21, and the TK domain of erbB2, encoded by exons 19-24, were directly sequenced in NSCLC tumor specimens. Genomic DNA was extracted by proteinase K digestion method.

PCR consisted of 40 cycles using an annealing temperature of 55�C in a 15 <�>l reaction mixture containing 7.5 <�>l HotStar MasterMix, 1.5 <�>l 5xQ-solution (Invitrogen, Carlsbad, CA, USA) and 0.25 <�>l of each primer (listed below). Primers were designed by Primer3 software (frodo.wi.mit.edu/cgi-bin/primer3). PCR products were then secuenced using Big Dye v3.1 terminator technology and the ABI 3730 analyzer (Applied Biosystems, Perkin-Elmer Corp., Norwalk, CT, USA) according to the manufacturer�s recommendation for mutation analysis.

Primers for mutation analysis in EGFR gene: exon 18 sense GCTGAGGTGACCCTTGTCTC; exon 18 antisense ACAGCTTGCAAGGACTC TGG; exon 19 sense CATGTGGCACCATCTCACA; exon 19 antisense CAGCTGCCAGACATGAGAAA; exon 20 sense CACACTGACGTGGCCTC TCC; exon 20 antisense TATCTCCCCTCCCCGTATCT; exon 21 sense CCTCACAGCAGGGTCTTCTC and exon 21 antisense CCTGGTGTCAGGA AAATGCT.

Primers for mutation analysis in erbB2 gene: exon 19 sense GATCTCCTGGAAGGCAGGTA; exon 19 antisense AGGTCTGGGCTCTGGTC TCT; exon 20 sense CTCTCAGCGTACCCTTGTCC; exon 20 antisense CCTAGCCCCTTGTGGACATA; exon 21 sense CAGAAGGTCTACATGGGT GCT; exon 21 antisense TTCTCCCATGGGCTAGACAC; exon 22 sense CTCCCCACAACACACAGTTG; exon 22 antisense AGCTCTCATCCTCCCTC CAG; exon 23 sense CTCCCACTCCTGACCCTGT; exon 23 antisense AGGACCTCCCACCCTCCT; exon 24 sense AGAGGCAGCAAGCACACAG and exon 24 antisense GAGGGTGCTCTTAGCCACAG.

RESULTS

In EGFR gene, somatic in-frame mutations were detected 3.3% of the NSCLC samples. The mutations consisted of 2 in-frame deletions who were detected in exon 19, around the ATP-binding pocket of the tyrosine-kinase domain.

Although Lynch et al. proposed the screening for mutations in EGFR-TK domains to identify lung cancer patiens who will have response to gefitinib, current data suggest that mutational spectra may be only one criteria for prediction of response to EGFR-TK inhibitors, among other criterias that may be considered (Weber et al.2005).

References

  1. Lynch TJ, Bell DW, et al; Activating mutations in the EGFR underlying responsiveness of non-small-cell lung cancer to gefitinib. N England J Med 2004, 350:2129-2139.
  2. Nguyen DM, Schrump DS, et al; Growth factor receptors as targets for lung cancer therapy. Semin Thorac Cardiovasc Surg 2004, 16:3-12.
  3. Nicholson RI, Gee JM et al; EGFR and cancer prognosis. Eur J Cancer 2001, 37:S9-S15.
  4. Speake G, Holloway B, et al; Recent developments related to the EGFR as a target for cancer chemotherapy. Current op Pharm 2005, 5: 343-349.
  5. Tracy S, Mukohara T, et al ; Gefitinib induces apoptosis in the EGFR non-small-cell lung cancer cell line H3255. Cancer res 2004, 64, 7241-7244.
  6. Weber F, Fukino K, et al; Variability in organ-specific EGFR mutational spectra in tumour epithelium and stroma may be the biological basis for differential responses to tyrosine kinase inhibitors. British J Cancer 2005, 1-5.

ACKNOWLEDGEMENT:

Juan Manuel Fern�ndez ALONSO, MS received an IFCC scholarship from the Professional Scientific Exchange Programme for a 6 months visit in 2004/2005 at the Ohio State University, US.